Optimized Platelet Rich Fibrin with the Low Speed Concept: Growth Factor Release, Biocompatibility and Cellular Response
Masako Fujioka-Kobayashi1,2,3#, Richard J. Miron1#*, Maria Hernandez1, Umadevi Kandalam4, Yufeng Zhang5, Joseph Choukroun6
1Department of Periodontology, College of Dental Medicine, Nova Southeastern University, Fort Lauderdale, Florida, USA; 2Department of Cranio-Maxillofacial Surgery, University of Bern, Bern, Switzerland; 3Department of Oral Surgery, Clinical Dentistry, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan; 1Department of Pediatric Dentistry, College of Dental Medicine, Nova Southeastern University, Fort Lauderdale, Florida, USA 6Pain Clinic, Nice, France
Abstract
Background: Over the past decade, the use of leukocyte platelet rich fibrin (L-PRF) has gained tremendous momentum in regenerative dentistry as a low-cost fibrin matrix utilized for tissue regeneration. In this study, we characterize how centrifugation speed (G-force) along with centrifugation time influence growth factor release from fibrin clots, as well as the cellular activity of gingival fibroblasts exposed to each PRF matrix.
Methods: Standard L-PRF served as a control (2700rpm-12 minutes). Two test groups utilizing low-speed (1300rpm-14 min termed advanced-PRF, A-PRF) and low-speed+time (1300rpm-8 min; A-PRF+) were investigated. Each PRF matrix was tested for growth factor release up to 10 days (8 patient samples) as well as biocompatibility and cellular activity.
Results: The low speed concept (A-PRF, A-PRF+) demonstrated a significant increase in growth factor release of PDGF, TGF- β1, EGF and IGF with A-PRF+ being highest of all groups. While all PRF formulations were extremely biocompatible due to their autogenous sources, both A-PRF and A-PRF+ demonstrated significantly higher levels of human fibroblast migration and proliferation when compared to L-PRF. Furthermore, gingival fibroblasts cultured with A-PRF+ demonstrated significantly higher mRNA levels of PDGF, TGF-β1 and collagen1 at either 3 or 7 days.
Conclusions: The findings from the present study demonstrate that modifications to centrifugation speed and time with the low-speed concept was shown to favor an increase in growth factor release from PRF clots which in turn may directly influence tissue regeneration by increasing fibroblast migration, proliferation and collagen synthesis. Future animal and clinical studies are now necessary.
Keywords: platelet rich fibrin, PRF, platelet concentrates, growth factor release, tissue regeneration, autogenous blood concentrates
Introduction
Over 15 years ago, platelet rich fibrin (PRF) was introduced as an autogenous source of blood growth factors that could serve as a tool for tissue regeneration in modern medicine (Choukroun et al., 2001). The concepts were derived from the fact that a first generation platelet concentrate, termed platelet rich plasma (PRP), was being heavy utilized in various fields of medicine despite bearing the negative aspect of containing anti-coagulants, thereby preventing the full coagulation cascade important for tissue wound healing (Anfossi et al., 1989; Fijnheer et al., 1990; Marx, 2004). PRF (which has since been renamed leukocyte-PRF or L-PRF due to its higher leukocyte content) does not contain any anti-coagulants and further provides a three-dimensional fibrin matrix that may be utilized as a scaffold for a variety of procedures including serving the function as a barrier membrane in guided bone and tissue regeneration (GBR, GTR) procedures (Lekovic et al., 2012a; Shivashankar et al., 2013; Toffler, 2014).
Since its introduction in 2001 (Choukroun et al., 2001), PRF has been extensively utilized in dentistry for a variety of procedures demonstrating its effectiveness for extraction socket management (Hoaglin and Lines, 2013), gingival recessions (Agarwal et al., 2016b; Aroca et al., 2009; Padma et al., 2013), intrabony defect regeneration (Agarwal et al., 2016a; Elgendy and Abo Shady, 2015) and sinus elevation procedures (Shivashankar et al., 2013). Major advantages include having completely immune-compatible growth factors collected at relatively no costs without anti-coagulants (Albanese et al., 2013; Medina-Porqueres and Alvarez-Juarez, 2015; Panda et al., 2014a; Salamanna et al., 2015). While initial and early experiments revealed that PRP contained high concentrations of autologous growth factors (up to 6-8 times higher than normal blood concentrations) including platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF) and transforming growth factor-Beta1 (TGF-β1) (Peerbooms et al., 2010), PRF has since been shown to release even higher total growth factors over a more extended period of time (Kobayashi et al., 2016).
One of the primary proposed reasons for a slower release of growth factors over time, is the ability for the fibrin matrix to hold proteins within its fibrin network as well contains cells capable of further release growth factors into their surrounding micro-environment (Kumar and Shubhashini, 2013; Lekovic et al., 2012b; Panda et al., 2014b; Pradeep et al., 2012; Sharma and Pradeep, 2011). Leukocytes have been shown to be highly important immune cells capable of directing and recruiting various cell types during the wound healing process (Barrick et al., 1999; Bielecki et al., 2012; Martin, 1997). Since high centrifugation forces are known to shift cell populations to the bottom of collection tubes (whereas PRF is collected from the top one-third layer), it was recently hypothesized that by reducing centrifugation G-force, an increase in leukocyte numbers may be achieved within the PRF matrix (Ghanaati et al., 2014). It was since shown that by decreasing centrifugation g-force (now termed advanced-PRF or A-PRF) an increase in total leukocyte numbers within PRF matrix scaffolds was observed (Ghanaati et al., 2014). Furthermore and in agreement with this hypothesis, it was further shown that the release of several growth factors including PDGF, TGF-β1, VEGF, as well as epidermal growth factor (EGF), and insulin-like growth factor (IGF) were significantly higher in A-PRF when compared to L-PRF and PRP (Kobayashi et al., 2016).
Since centrifugation force has been shown to have a direct impact on growth factor release from within PRF scaffolds (Kobayashi et al., 2016), the aim of the present study was to further investigate whether centrifugation time would similarly further improve growth factor release from within PRF scaffolds. In principle, less centrifugation time would reduce cell pull-down by centrifugation forces, which would theoretically increase the total number of cells left contained within the top layer (PRF matrix). Furthermore, since at present it remains completely unknown what influence these changes to centrifugation protocols will have on tissue regeneration, the effects of each PRF matrix including L-PRF, A-PRF and A-PRF+ was investigated for the first time on human gingival fibroblast cell biocompatibility and cell activity. Cells were therefore cultured with growth factors from each PRF matrix (L-PRF, A-PRF and A-PRF+) and investigated for cell migration, proliferation, growth factor release and collagen synthesis in vitro.
2. Materials and methods
Platelet concentrations
Blood samples were collected with the informed consent of 8 volunteer donors (24 total samples) and blood was then processed for L-PRF, A-PRF, A-PRF+ centrifugation. All blood samples were obtained from members of our laboratory between the ages of 30 and 60. Ten ml of whole blood without anticoagulant was centrifuged at 2,700 rpm for 12 min for L-PRF, at 1,300 rpm for 14 min for A-PRF, and at 1,300 rpm for 8 min for A-PRF+ respectively by Choukroun PRF Duo Centrifuge (Process for PRF, Nice, France) (Ghanaati et al., 2014; Kobayashi et al., 2016). The collected L-PRF, A-PRF and A-PRF+ clots were then transferred to 6 well in vitro plastic culture dishes with 5 ml of culture media (DMEM; Gibco, Life technologies, Carlsbad, CA, USA) and processed as further described.
Protein quantification with ELISA
In order to determine the amount of released growth factors from L-PRF, A-PRF, and A-PRF+ at 15 min, 60 min, 8 hours, 1 day, 3 days and 10 days, samples were placed into a shaking incubator at 37°C to allow for growth factor release into the culture media. At each time point, the 5 ml of culture media was collected, frozen and replaced with 5 ml of additional culture media. Protein quantification was carried out using ELISA. At desired time points, PDGF-AA (DY221, range = 15.60 - 1,000 pg/ml), PDGF-AB (DY222, range = 15.60 - 1,000 pg/ml), PDGF-BB (DY220, 31.20 - 2,000 pg/ml), TGF-β1 (DY240, range = 31.20 - 2,000 pg/ml), VEGF (DY293B, range = 31.20 - 2,000 pg/ml), EGF (DY236, range = 3.91 - 250 pg/ml) and IGF-1 (DY291, range = 31.20 - 2,000 pg/ml) were quantified using an ELISA kit (DuoSet, R&D Systems, Minneapolis, MN, USA) according to manufacturer’s protocol as previously described (Kobayashi et al., 2016). Absorbance was measured at 450 nm and 570 nm using a DTX880 microplate reader (Beckman Coulter, Brea, California, USA) and subtract at 570 nm from the readings at 450 nm. All samples were measured in duplicate and 3 independent experiments were performed for each platelet concentrate.
Cell culture
Platelet concentrates including L-PRF, A-PRF, and A-PRF+ were incubated for 3 days in a spinning chamber at 37 °C and thereafter conditioned media was collected and utilized in future experiments as 20% of the total volume. Human gingival fibroblasts were purchased from ATCC (HGF-1, Manassas, VA, USA). All cells were detached from tissue culture plastic using 0.25% EDTA-Trypsin (Gibco) prior to reaching confluency. Cells used for experimental seeding were from passages 4-6. Cells were cultured in a humidified atmosphere at 37°C in growth medium consisting of DMEM (Gibco), 10% fetal bovine serum (FBS; Gibco), and 1% antibiotics (Gibco). Cells were seeded with 20% conditioned media from L-PRF, A-PRF and A-PRF+ in contained within growth medium at a density of 10,000 cells for cell viability and proliferation experiments and 50,000 cells for real-time PCR, collagen immunofluorescent staining per well in 24-well plates. For experiments lasting longer than 5 days, medium was replaced twice weekly.
Cell viability
At 24 hours post cell seeding, cells were evaluated using a live-dead staining assay according to the manufacturer’s protocol (Enzo Life Sciences AG; Lausen, Switzerland). Fluorescent images were quantified with an inverted fluorescent microscope (IX51, OLYMPUS, Tokyo, Japan). Thereafter, cells were expressed as percentages of live versus dead cells following cell culture growth with L-PRF, A-PRF and A-PRF+.
Cell migration assay
The migration assay of human gingival fibroblasts was performed using 24-well plates and polyethylene terephthalate cell culture inserts with a pore size of 8 μm (Falcon, Corning Inc., Corning, NY, USA). The 20% platelet conditioned media in DMEM containing 10% FBS were filled into the lower compartment of the wells. After starved in DMEM containing 0.5% FBS for 12 hours, resuspended 10,000 cells were seeded in the upper compartment. After 24 hours, cells were fixed with 4% formaldehyde for 2 min. Thereafter cells were permeabilized by Acetone for 15 min and stained with Hematoxylin solution (Sigma, St. Louis, MO, USA) for 20 min. The upper side of the filter membrane were rinsed and gently wiped by a cotton swab to remove the cell debris. The numbers of cells on the lower side of the filter were counted under a microscope.
Proliferation assay
Human gingival fibroblasts were quantified using a MTS colorimetric assay (Promega, Madison, WI, USA) at 1, 3 and 5 days for cell proliferation as previously described (Fujioka-Kobayashi et al., 2016). At desired time points, cells were washed with phosphate buffered solution (PBS) and quantified using a DTX880 microplate reader.
Real-time PCR analysis
Total RNA was harvested at 3 and 7 days post stimulating for human gingival fibrobalsts to investigate mRNA levels of TGF-β, PDGF and collagen1a2 (COL1a2). Primer and probe sequences for genes were fabricated with Primer sequences according to Table 1. RNA isolation was performed using High Pure RNA Isolation Kit (Roche, Basel, Switzerland). Real-time RT-PCR was performed using Roche Master mix and quantified on the StepOne™ plus Real time PCR system from Applied Biosystems (Foster City, CA, USA). The ∆∆Ct method was used to calculate gene ｅxpression levels normalized to the ｅxpression of GAPDH.
Collagen immunofluorescent staining
At 14 days post seeding, human gingival fibroblasts were fixed with 4% formaldehyde for 10 min, followed by permealized within PBS containing 0.2% Triton X-100 and blocked in PBS containing 1% bovine serum albumin (BSA, Sigma) for 1 hour. Subsequently, cells incubated for over night at 4°C with polyclonal rabbit to collagen type I antibodies (sc-28657, Santa Cruz, California, USA) diluted 1:100 in PBS containing 1% BSA. After washing with PBS, cells were incubated for 1 hour at 37°C with FITC-conjugated-goat-anti-rabbit antibodies (sc-2012, Santa Cruz) (1:200) diluted in PBS containing 1% BSA. Prior to viewing, samples were mounted with Vectashield containing DAPI nuclear staining (Vector, Burlingame, CA, USA). Images were captured from each surface on an inverted Olympus fluorescence microscope. The optical density (OD) of the fluorescent collagen staining was quantified from 3 independent experiments using Image J software.
Statistical analysis
All experiments were performed in triplicate with three independent experiments for each condition. Means and standard errors (SE) were calculated and data were analyzed for statistical significance using one-way analysis for cell viability, migration assay, and collagen staining, two-way analysis of variance for ELISA, proliferation assay and real time PCR analysis with Turkey test (*, p values < 0.05 was considered significant) by GraphPad Prism 6.0 software (GraphPad Software, Inc., La Jolla, CA, USA).
Results
Growth factor release from PRF, A-PRF and A-PRF+
In a first set of experiments, the release of growth factors including PDGF-AA, PDGF-AB, PDGF-BB, TGF-β1, VEGF, EGF and IGF were quantified by ELISA (Fig. 1, 2). While the growth factor release of PDGF-AA demonstrated a significant increase for A-PRF+ at 3 days when compared to L-PRF (Fig. 1A), no difference in total growth factor released was observed between the 3 treatment groups (Fig. 1B). Release of PDGF-AB demonstrated a significant increase for A-PRF+ when compared to PRF at 8 hours, and a significant increase at 1, 3 and 10 days when compared to all other groups (Fig. 1C). L-PRF demonstrated significantly lower values than A-PRF and A-PRF+ at both 1 and 3 days (Fig. 1C). The total growth factor release was significantly higher for A-PRF+ when compared to all modalities while L-PRF was significantly lowest (Fig. 1D). Similarly, the release of PDGF-BB demonstrated significantly highest values at almost all time points for A-PRF+ with L-PRF once again demonstrating significantly lower values when compared to A-PRF and A-PRF+ (Fig. 1E, 1F).
The release of TGF-β1 also demonstrated a similar trend whereby A-PRF+ demonstrated significantly highest values at 1, 3 and 10 days (Fig. 2A) and the total release of growth factors after a 10-day period almost 3 times significantly higher when compared to control L-PRF (Fig. 2B). Interestingly, A-PRF+ demonstrated a significantly higher release of VEGF at an early time point of 1 day (Fig. 2C) whereas little change was observed in the total growth factor release (Fig. 2D). Release of growth factors EGF and IGF confirmed that the low speed concept favoured the release of both growth factors from A-PRF+ when compared to A-PRF and L-PRF (Fig. 2E-H).
Biocompatibility of L-PRF, A-PRF and A-PRF+ on human gingival fibroblasts
In a first cell culture experiment the influence of L-PRF, A-PRF and A-PRF+ was investigated on cell viability of human gingival fibroblasts. It was found that all platelet formulations displayed excellent cell biocompatibility by demonstrating most notably high living cells (green cells, Fig, 3) with very few observable apoptotic cells (red cells). It may therefore be concluded from this experiment that each platelet rich fibrin formulation including L-PRF, A-PRF and A-PRF+ are fully biocompatible under the present in vitro cell culture model (Fig. 3).
Influence of PRF, A-PRF and A-PRF+ on human gingival fibroblast activity
Following growth factor release experiments, each PRF formulation was investigated on gingival fibroblast cell migration, proliferation, ｅxpression of growth factors and collagen synthesis (Figs. 4-6). It was first observed that all PRF matrix scaffolds were able to significantly promote gingival fibroblast migration at 24 hours with control L-PRF inducing a 200% increase whereas A-PRF and A-PRF+ induced a 300% increase (Fig. 4A). No significant difference between A-PRF and A-PRF+ was observed although both were significantly higher than control L-PRF (Fig. 4A). A similar trend was also observed for cell proliferation where each of L-PRF, A-PRF and A-PRF+ significantly increase cell numbers at both 3 and 5 days when compared to control tissue culture plastic, and A-PRF and A-PRF+ were significantly higher than all other groups at 5 days only (Fig. 4B).
Thereafter, mRNA levels of common regenerative cytokines PDGF and TGFB1 were evaluated by real-time PCR (Fig. 5). It was first found that A-PRF and A-PRF+ provoked a slight significant increase in PDGF mRNA levels at 3 days when compared to control tissue culture plastic (Fig. 5A). At 7 days, L-PRF demonstrated a significant increase when compared to control TCP whereas both A-PRF and A-PRF+ once again provoked a significant increase in PDGF mRNA levels when compared to all other groups (Fig. 5A). No significant difference was observed between A-PRF and A-PRF+ at either time point (Fig. 5A). Thereafter growth factor release of TGF-β1 from gingival fibroblasts was investigated (Fig. 5B). It was observed that while no difference was present at 3 days post-seeding, a significant increase was observed for all PRF groups at 7 days (Fig. 5B). It was found that A-PRF+ demonstrated significantly highest mRNA levels at 7 days when compared to all other groups including control TCP, control L-PRF as well as A-PRF (Fig. 5B).
Lastly, collagen mRNA levels and collagen protein levels were quantified by real-time PCR (Fig. 5C) and immunofluorescent staining (Fig. 6) respectively. At 3 days, mRNA levels of collagen1 were significantly higher in A-PRF and A-PRF+ groups when compared to control with no significant differences observed for L-PRF (Fig. 5C). At 7 days post seeding, L-PRF demonstrated significantly higher values when compared to control tissue culture plastic and A-PRF demonstrated statistically significantly higher values when compared to control TCP and L-PRF (Fig. 5C). A-PRF+ demonstrated significantly highest mRNA values when compared to all other groups (Fig. 5C). Thereafter, it was shown that while L-PRF demonstrated a slight non-significant increase in immunofluorescent staining of collagen type 1 when compared to control tissue culture plastic, both A-PRF and A-PRF+ demonstrated marked and significant 300% increases in collagen synthesis when compared to control TCP (Fig. 6).
Discussion
The aim of the present study was to investigate the influence of centrifugation speed (g-force) and time on PRF matrix scaffolds, their release of growth factors as well as their effect on cellular biocompatibility and activity. As the use of PRF has continuously and steadily increased in regenerative implant dentistry and periodontology, there remains great clinical benefit to optimize centrifugation protocols for clinical practice. Therefore, the aim of the present study was to first investigate the recent findings from Ghanaati et al., and thereafter to determine if lower centrifugation speeds and time could be additionally used to improve growth factor release and cell bioactivity (Ghanaati et al., 2014). In that previous study, one of the interesting findings when quantifying cells found in the PRF matrix histologically was the observation that the majority of leukocytes were found near the bottom of the fibrin clot (Ghanaati et al., 2014). Based on this finding, it became clear that centrifugation speeds (g-forces) were evidently too high pushing leukocytes down to the bottom of centrifugation tubes and away from the PRF matrix clot. In order to redistribute leukocyte cell numbers across the entire PRF matrix, lower centrifugation speeds were investigated (Ghanaati et al., 2014). It was therefore found that higher cell number could be obtained by reducing g-force during centrifugation (Ghanaati et al., 2014). In theory, the practical application of these new centrifugation protocols are derived by minimizing centrifugation speeds in order to limit the centrifugation pull-down of leukocyte cells to the lower compartment of centrifugation tubes. By reducing centrifugation g-force and time, a higher percentage of cells can therefore be collected within the top layer where PRF clots are located and utilized clinically.
It must also be noted that the role of leukocytes in tissue wound healing and bone biology has been extensively discussed and critically important to wound healing (Barrick et al., 1999; Bielecki et al., 2012; Martin, 1997). Interesting findings from basic science now point to the absolute necessity of macrophages during bone tissue remodelling (Sinder et al., 2015) and have further shown that macrophages are responsible for a 23-fold increase in osteoblast differentiation (Chang et al., 2008). Without these key immune cells, it has bone shown that bone formation hardly has the potential to take place (Sinder et al., 2015). Furthermore, macrophages are key players in biomaterial integration and are the responsible cell type dictating material integration (Miron and Bosshardt, 2016). Therefore it becomes evident that both an increase in leukocyte number as well as their even distribution across the PRF scaffold as demonstrated with lower centrifugation speeds is highly favourable during tissue wound healing and during biomaterial integration of collagen barrier membranes, various classes of bone grafting materials and possibly even titanium dental implants (Miron and Bosshardt, 2016).
Another important aspect of leukocyte biology that has not been discussed in this study but again shows much clinical relevance is the fact leukocytes are the responsible cell-type acting to prevent infiltrating pathogens (Mosser and Edwards, 2008; Ramilo et al., 2007). In light of this fact, it becomes of interest to note that PRF placed into extraction sockets has been shown to greatly decrease the rate of complications and infections (Hoaglin and Lines, 2013). For instance, Hoaling and Lines reported that filling 3rd molar extraction sockets with PRF led to a 10 fold decrease in osteomyelitis infections when compared to natural healing (Hoaglin and Lines, 2013). This study was performed in 200 patients where the study design utilized bilateral extractions (one side filled with PRF, the other left to naturally heal) providing good scientific evidence for the reduced rate of infection following healing with PRF (Hoaglin and Lines, 2013).
In the present study, we first investigated growth factor release from the various PRF matrix scaffolds produced by 3 different centrifugation protocols utilizing a slower-speed concept (Fig. 1, 2). It was reported that A-PRF+ demonstrated significantly higher total growth factor release when compared to both A-PRF as well as L-PRF. We therefore hypothesized that this finding is directly correlated with the fact that a higher number of leukocytes are found contained within the A-PRF+ scaffolds centrifuged utilizing lower g-forces and centrifugation times. This finding alone is deemed highly clinically relevant and these slight changes in centrifugation protocols were shown to have a direct and pronounced impact on growth factor release from within these A-PRF+ scaffolds.
Following the analysis of growth factor release from PRF matrix scaffolds, our group then sought to characterize the influence of L-PRF, A-PRF and A-PRF+ on cell biocompatibility and cell activity (Fig. 3-6). It was first found that all PRF centrifugation protocols led to extremely high biocompatibility due to the autogenous source of these growth factors without use of anti-coagulants (Fig. 3). Interestingly, it was found that A-PRF and A-PRF+ significantly promoted higher human gingival cell migration and proliferation when compared to control TCP and L-PRF (Fig. 4). Furthermore, analysis of mRNA levels of PDGF and TGF-β1 also demonstrate the ability for PRF matrix scaffolds produced with the low speed concept to significantly increase the production of released growth factors from gingival fibroblasts. Therefore, not only are higher quantities of PDGF and TGF-β1 found in A-PRF+ scaffolds themselves (Fig. 1, 2), but the cells then in contact with their matrix are also further stimulated to release more growth factors (Fig. 5), thus having a synergistic effect on the total growth factors produced locally.
Lastly we showed also that A-PRF and A-PRF+ samples were able to locally increase up to a 300% significant increase in collagen1 synthesis (Fig. 6). Not surprisingly, collagen remains one of the key factors during tissue wound healing and remodeling (Chattopadhyay and Raines, 2014; Chu et al., 1991; Clark, 2013). Therefore the 3 fold increase in collagen type 1 synthesis when cells were exposed to A-PRF and A-PRF+ further demonstrates the regenerative potential of the newer PRF formulations centrifuged at lower g-forces and lower centrifugation times.
In summary, the results from the present study demonstrate that all formulations of PRF matrix scaffolds including PRF, A-PRF and A-PRF+ were able to secrete the local release of various growth factors important for tissue regeneration and A-PRF+ demonstrated significantly higher release of growth factors when compared to all other groups. Furthermore, A-PRF and A-PRF+ matrix scaffolds were shown to directly impact the ability for human gingival fibroblasts to migrate, proliferate, release additional growth factors and produce type 1 collagen. The findings from the present study demonstrate that modifications to centrifugation speed and time with the low-speed concept favors an increase in growth factor concentrations directly impacting human gingival fibroblasts. Future animal and clinical studies are now needed to further confirm the effects of these results in vivo.
Figure Legends
Figure 1: ELISA protein quantification at each time point of (A) PDGF-AA, (C) PDGF-AB and (E) PDGF-BB over a 10 day period. Total accumulated growth factor released over a 10 day period for (B) PDGF-AA, (D) PDGF-AB and (F) PDGF-BB. (* p<0.05 signifies significant difference between groups, ** p<0.05 signifies significantly higher than all other groups, # p<0.05 signifies significantly lower than all groups).
Figure 2: ELISA protein quantification at each time point of (A) TGF-β1, (C) VEGF (E) EGF and (G) IGF-1 over a 10 day period. Total accumulated growth factor released over a 10 day period for (B) TGF-β1, (D) VEGF, (F) EGF and (H) IGF-1. (* p<0.05 signifies significant difference between groups, ** p<0.05 signifies significantly higher than all other groups, # p<0.05 signifies significantly lower than all groups).
Figure 3: Live/Dead assay at 24 hours of human gingival fibroblasts treated with L-PRF, A-PRF or A-PRF+ (A) The merged fluorescent images of Live/Dead staining with viable cell appearing in green and dead cells in red. (B) Cell viability was quantified with percentage of numbers of living cells in each group. No significant changes in cell viability were observed for all platelet concentrates.
Figure 4: Effects of L-PRF, A-PRF and A-PRF+ on human gingival fibroblast (A) cell migration at 24 hours and (B) cell proliferation at 1, 3 and 5 days. (* denotes significantly higher than control group p<0.05, ** denotes significantly higher than all other groups p<0.05)
Figure 5: Real-time PCR of human gingival fibroblasts treated with L-PRF, A-PRF or A-PRF+ at 3 and 7 days for mRNA levels of (A) TGF-β, (B) PDGF and (C) COL1a2. (* denotes significant difference between groups, p<0.05, ** denotes significantly higher than all other groups p<0.05)
Figure 6: Immunofluorescent collagen1 (COL1) staining of human gingival fibroblast treated with L-PRF, A-PRF and A-PRF+ at 14 days. (A) The merged fluorescent images of COL1 staining (green) with DAPI staining (blue). (B) Quantified values of COL staining in comparison with control samples (* denotes significantly higher than control group p<0.05)
Table 1: List of primer sequences for real-time PCR
|
Gene |
Primer Sequence |
|
hTGF-β F |
actactacgccaaggaggtcac |
|
hTGF-β R |
tgcttgaacttgtcatagatttcg |
|
hPDGF F |
cacacctcctcgctgtagtattta |
|
hPDGF R |
gttatcggtgtaaatgtcatccaa |
|
hCOL1a2 F |
cccagccaagaactggtatagg |
|
hCOL1a2 R |
ggctgccagcattgatagtttc |
|
hGAPDH F |
agccacatcgctcagacac |
|
hGAPDH R |
gcccaatacgaccaaatcc |
References
Agarwal A, Gupta ND, Jain A (2016a). Platelet rich fibrin combined with decalcified freeze-dried bone allograft for the treatment of human intrabony periodontal defects: a randomized split mouth clinical trail. Acta odontologica Scandinavica 74(1):36-43.
Agarwal SK, Jhingran R, Bains VK, Srivastava R, Madan R, Rizvi I (2016b). Patient-centered evaluation of microsurgical management of gingival recession using coronally advanced flap with platelet-rich fibrin or amnion membrane: A comparative analysis. European journal of dentistry 10(1):121-133.
Albanese A, Licata ME, Polizzi B, Campisi G (2013). Platelet-rich plasma (PRP) in dental and oral surgery: from the wound healing to bone regeneration. Immunity & ageing : I & A 10(1):23.
Anfossi G, Trovati M, Mularoni E, Massucco P, Calcamuggi G, Emanuelli G (1989). Influence of propranolol on platelet aggregation and thromboxane B2 production from platelet-rich plasma and whole blood. Prostaglandins, leukotrienes, and essential fatty acids 36(1):1-7.
Aroca S, Keglevich T, Barbieri B, Gera I, Etienne D (2009). Clinical evaluation of a modified coronally advanced flap alone or in combination with a platelet-rich fibrin membrane for the treatment of adjacent multiple gingival recessions: a 6-month study. Journal of periodontology 80(2):244-252.
Barrick B, Campbell EJ, Owen CA (1999). Leukocyte proteinases in wound healing: roles in physiologic and pathologic processes. Wound Repair and Regeneration 7(6):410-422.
Bielecki T, Dohan Ehrenfest DM, Everts PA, Wiczkowski A (2012). The role of leukocytes from L-PRP/L-PRF in wound healing and immune defense: new perspectives. Current pharmaceutical biotechnology 13(7):1153-1162.
Chang MK, Raggatt LJ, Alexander KA, Kuliwaba JS, Fazzalari NL, Schroder K et al. (2008). Osteal tissue macrophages are intercalated throughout human and mouse bone lining tissues and regulate osteoblast function in vitro and in vivo. Journal of immunology (Baltimore, Md : 1950) 181(2):1232-1244.
Chattopadhyay S, Raines RT (2014). Review collagen‐based biomaterials for wound healing. Biopolymers 101(8):821-833.
Choukroun J, Adda F, Schoeffler C, Vervelle A (2001). Une opportunité en paro-implantologie: le PRF. Implantodontie 42(55):e62.
Chu GH, Ogawa Y, McPherson JM, Ksander G, Pratt B, Hendricks D et al. (1991). Collagen wound healing matrices and process for their production: Google Patents.
Clark R (2013). The molecular and cellular biology of wound repair: Springer Science & Business Media.
Elgendy EA, Abo Shady TE (2015). Clinical and radiographic evaluation of nanocrystalline hydroxyapatite with or without platelet-rich fibrin membrane in the treatment of periodontal intrabony defects. Journal of Indian Society of Periodontology 19(1):61-65.
Fijnheer R, Pietersz RN, de Korte D, Gouwerok CW, Dekker WJ, Reesink HW et al. (1990). Platelet activation during preparation of platelet concentrates: a comparison of the platelet-rich plasma and the buffy coat methods. Transfusion 30(7):634-638.
Fujioka-Kobayashi M, Sawada K, Kobayashi E, Schaller B, Zhang Y, Miron RJ (2016). Osteogenic potential of rhBMP9 combined with a bovine-derived natural bone mineral scaffold compared to rhBMP2. Clin Oral Implants Res.
Ghanaati S, Booms P, Orlowska A, Kubesch A, Lorenz J, Rutkowski J et al. (2014). Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral implantology 40(6):679-689.
Hoaglin DR, Lines GK (2013). Prevention of localized osteitis in mandibular third-molar sites using platelet-rich fibrin. International journal of dentistry 2013(875380.
Kobayashi E, Fluckiger L, Fujioka-Kobayashi M, Sawada K, Sculean A, Schaller B et al. (2016). Comparative release of growth factors from PRP, PRF, and advanced-PRF. Clinical oral investigations.
Kumar RV, Shubhashini N (2013). Platelet rich fibrin: a new paradigm in periodontal regeneration. Cell and tissue banking 14(3):453-463.
Lekovic V, Milinkovic I, Aleksic Z, Jankovic S, Stankovic P, Kenney E et al. (2012a). Platelet‐rich fibrin and bovine porous bone mineral vs. platelet‐rich fibrin in the treatment of intrabony periodontal defects. Journal of periodontal research 47(4):409-417.
Lekovic V, Milinkovic I, Aleksic Z, Jankovic S, Stankovic P, Kenney EB et al. (2012b). Platelet-rich fibrin and bovine porous bone mineral vs. platelet-rich fibrin in the treatment of intrabony periodontal defects. Journal of periodontal research 47(4):409-417.
Martin P (1997). Wound healing--aiming for perfect skin regeneration. Science 276(5309):75-81.
Marx RE (2004). Platelet-rich plasma: evidence to support its use. Journal of oral and maxillofacial surgery : official journal of the American Association of Oral and Maxillofacial Surgeons 62(4):489-496.
Medina-Porqueres I, Alvarez-Juarez P (2015). The Efficacy of Platelet-Rich Plasma Injection in the Management of Hip Osteoarthritis: A Systematic Review Protocol. Musculoskeletal care.
Miron RJ, Bosshardt DD (2016). OsteoMacs: Key players around bone biomaterials. Biomaterials 82(1-19.
Mosser DM, Edwards JP (2008). Exploring the full spectrum of macrophage activation. Nature reviews immunology 8(12):958-969.
Padma R, Shilpa A, Kumar PA, Nagasri M, Kumar C, Sreedhar A (2013). A split mouth randomized controlled study to evaluate the adjunctive effect of platelet-rich fibrin to coronally advanced flap in Miller's class-I and II recession defects. Journal of Indian Society of Periodontology 17(5):631-636.
Panda S, Doraiswamy J, Malaiappan S, Varghese SS, Del Fabbro M (2014a). Additive effect of autologous platelet concentrates in treatment of intrabony defects: a systematic review and meta-analysis. Journal of investigative and clinical dentistry.
Panda S, Jayakumar ND, Sankari M, Varghese SS, Kumar DS (2014b). Platelet rich fibrin and xenograft in treatment of intrabony defect. Contemporary clinical dentistry 5(4):550-554.
Peerbooms JC, van Laar W, Faber F, Schuller HM, van der Hoeven H, Gosens T (2010). Use of platelet rich plasma to treat plantar fasciitis: design of a multi centre randomized controlled trial. BMC Musculoskeletal Disorders 11(69-69.
Pradeep AR, Rao NS, Agarwal E, Bajaj P, Kumari M, Naik SB (2012). Comparative evaluation of autologous platelet-rich fibrin and platelet-rich plasma in the treatment of 3-wall intrabony defects in chronic periodontitis: a randomized controlled clinical trial. Journal of periodontology 83(12):1499-1507.
Ramilo O, Allman W, Chung W, Mejias A, Ardura M, Glaser C et al. (2007). Gene ｅxpression patterns in blood leukocytes discriminate patients with acute infections. Blood 109(5):2066-2077.
Salamanna F, Veronesi F, Maglio M, Della Bella E (2015). New and emerging strategies in platelet-rich plasma application in musculoskeletal regenerative procedures: general overview on still open questions and outlook. 2015(846045.
Sharma A, Pradeep AR (2011). Treatment of 3-wall intrabony defects in patients with chronic periodontitis with autologous platelet-rich fibrin: a randomized controlled clinical trial. Journal of periodontology 82(12):1705-1712.
Shivashankar VY, Johns DA, Vidyanath S, Sam G (2013). Combination of platelet rich fibrin, hydroxyapatite and PRF membrane in the management of large inflammatory periapical lesion. Journal of Conservative Dentistry 16(3):261.
Sinder BP, Pettit AR, McCauley LK (2015). Macrophages: Their Emerging Roles in Bone. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 30(12):2140-2149.
Toffler M (2014). Guided bone regeneration (GBR) using cortical bone pins in combination with leukocyte-and platelet-rich fibrin (L-PRF). Compendium of continuing education in dentistry (Jamesburg, NJ : 1995) 35(192-198.